|  Help  |  About  |  Contact Us

Allele : Mlh1<em7Jcs> mutL homolog 1; endonuclease-mediated mutation 7, John C Schimenti

Primary Identifier  MGI:7276208 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Mlh1
Strain of Origin  FVB/NJ x B6(Cg)-Tyr<c-2J>/J Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting AGGACGACGGCCCGAAGGAA) and an ssODN template (AAGTGGCTGGACAGAGGACGACGGCCCGAAAGAGGGCCTTGCAGAGTACATTGTTGAGTTTCTGAAGAAGGCAGCGGAGATGCTTGCAGACTATTTCTCTGTGGAGATCGATGAGGCGAG) with CRISPR/Cas9 technology, lysine codon 622 (AAA) was changed to alanine (GCA) (c.1864_1865delAAinsGC, p.K622A). This is the equivalent of the human p.K618A mutation.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Mlh1<K618A>,
  • Mlh1<K618A>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele