| Primary Identifier | MGI:7261227 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | C3 |
| Strain of Origin | NOD.Cg-Prkdc<scid> Il2rg<tm1Sug>/ShiJic | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 mediated recombination using 2 guide RNAs (CTTGACAGGAATGCCATCGG and CATCGATGACCCAAATGGCC) targeting exons 5 and 7 was used to create a 252 bp deletion spanning nucleotides 614 - 865 including all of exon 6 and parts of exons 5 and 7. ELISA confirmed the absence of mature protein in plasma from homozygous mice. |
