|  Help  |  About  |  Contact Us

Allele : C3<em1Takah> complement component 3; endonuclease-mediated mutation 1, Takeshi Takahashi

Primary Identifier  MGI:7261227 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  C3
Strain of Origin  NOD.Cg-Prkdc<scid> Il2rg<tm1Sug>/ShiJic Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 mediated recombination using 2 guide RNAs (CTTGACAGGAATGCCATCGG and CATCGATGACCCAAATGGCC) targeting exons 5 and 7 was used to create a 252 bp deletion spanning nucleotides 614 - 865 including all of exon 6 and parts of exons 5 and 7. ELISA confirmed the absence of mature protein in plasma from homozygous mice.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • C3<deltaMG2-3>,
  • C3<deltaMG2-3>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele