| Primary Identifier | MGI:7711741 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr366694 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Pax1 enhancer Xe1 was targeted using sgRNAs (equivalent to GAACTTAAGTGGTGGAGTCGAGG and ACTCATTTGCCAAGACCCATGGG) with CRISPR/Cas9 technology, resulting in ~3.2 kb deletions. Three strains were produced with the following deletions: GRCm39:chr2:147401677-147404891 (129-A), 147401678-147404882 (127-C), 147401675-147404886 (123-B). |
