|  Help  |  About  |  Contact Us

Allele : Abca6<em1Nju> ATP-binding cassette, sub-family A member 6; endonuclease-mediated mutation 1, Model Animal Research Center of Nanjing University

Primary Identifier  MGI:7256952 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Abca6
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting TGAGTTTGGATACTGCCCTC) and an ssODN template with CRISPR/Cas9 technology, cysteine codon 1366 (TGC) was changed to arginine (AGA) (p.C1366R). This mutation is associated with hypercholestrolemia in humans. Transcript levels from this allele are normal, but peptide expression in liver is barely detectable.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Abca6 C1366R,
  • Abca6 C1366R
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories