|  Help  |  About  |  Contact Us

Allele : Alx1<em1Jian> ALX homeobox 1; endonuclease-mediated mutation 1, Rulang Jiang

Primary Identifier  MGI:7258422 Allele Type  Endonuclease-mediated
Gene  Alx1 Strain of Origin  C57BL/6N
Is Recombinase  false Is Wild Type  false
molecularNote  CRISPR/Cas9 technology using sgRNAs targeting intron 1 (GTAAGATGTGGGTGGTACT) and intron 2 (TTACTAAGTATAGGGACAGG) deleted exon 2. Sequencing of RT-PCR products confirmed the production of mutant mRNAs from splicing exon 1 to exon 3, which leads to a frame-shift and is predicted to produce a truncated protein containing only the N-terminal region and lacking the homeodomain and the C-terminal Aristaless domain. Western blot analysis confirmed that embryos lack full-length protein and only produce truncated product that is expressed at low levels.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Alx1<del>,
  • Alx1<del>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories