|  Help  |  About  |  Contact Us

Allele : Slc2a1<em1Mase> solute carrier family 2 (facilitated glucose transporter), member 1; endonuclease-mediated mutation 1, Matthias Selbach

Primary Identifier  MGI:7282075 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Slc2a1
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting GAGGAGCTCTTCCACCCTCT) and an ssODN template (TAGCTGCCTGTGCTCCAGAGAGATCCTTGGGCTGCAGGGAGCAGGCCGGGCTGGGTGTGGGGCTCCTCACACTTGGGAGTCCGCCCCCAacaaGTGGAAGAGCTCCTCGGGTGTCTTGTCACTTTGG) with CRISPR/Cas9 technology, proline codon 485 (CCT) in exon 10 was changed to leucine (TTG) (p.P485L). This mutation creates a dileucine motif with the downstream (C-terminal) flanking leucine in the encoded peptide, which causes mislocalization away from the plasma membrane. The mutation is associated with the human childhood onset GLUT1 deficiency syndrome 2 (GLUT1 deficiency syndrome (G1DS)).
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • GLUT1_P485L,
  • GLUT1_P485L
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories