| Primary Identifier | MGI:7282075 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Slc2a1 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using an sgRNA (targeting GAGGAGCTCTTCCACCCTCT) and an ssODN template (TAGCTGCCTGTGCTCCAGAGAGATCCTTGGGCTGCAGGGAGCAGGCCGGGCTGGGTGTGGGGCTCCTCACACTTGGGAGTCCGCCCCCAacaaGTGGAAGAGCTCCTCGGGTGTCTTGTCACTTTGG) with CRISPR/Cas9 technology, proline codon 485 (CCT) in exon 10 was changed to leucine (TTG) (p.P485L). This mutation creates a dileucine motif with the downstream (C-terminal) flanking leucine in the encoded peptide, which causes mislocalization away from the plasma membrane. The mutation is associated with the human childhood onset GLUT1 deficiency syndrome 2 (GLUT1 deficiency syndrome (G1DS)). |
