| Primary Identifier | MGI:7284311 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Vcp |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Alanine codon 232 (GCG) was changed to glutamic acid (GAG) (p.A232E) using an sgRNA (targeting CCTGCGCTGTTTAAGGCGATTGG) and an ssODN template (AGATAAAGGAGATGGTGGAGCTGCCACTGAGACATCCTGCACTGTTTAAAGAGATTGGTGTAAAGGTGAGTATCCTAAGGTCTGTGGGGAGTCT) with CRISPR/Cas9 technology. The gain-of-function mutation is located in the D1 ATPase domain of the encoded peptide and is associated with multisystem proteinopathy in humans. |
