| Primary Identifier | MGI:7281504 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Del(3Rr80449-Rr80450)1Tcp |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| description | This deletes the mouse region homologous to the human SRR124-SRR134 region which is located 124-134 kb downstream of human SOX2. |
| molecularNote | This allele from project TCPR1896 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGGATTTCTGATCCCTACGC targeting the 5' side and TAGCATACGTCACGCCGGAA targeting the 3' side of the target region on Chr3. This resulted in a 9,032-bp deletion Chr3:34800126 to 34809158 (GRCm39). |
