|  Help  |  About  |  Contact Us

Allele : Del(3Rr80449-Rr80450)1Tcp Del(3)1Tcp; deletion, Chr 3, The Centre for Phenogenomics 1

Primary Identifier  MGI:7281504 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Del(3Rr80449-Rr80450)1Tcp
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
description  This deletes the mouse region homologous to the human SRR124-SRR134 region which is located 124-134 kb downstream of human SOX2.
molecularNote  This allele from project TCPR1896 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGGATTTCTGATCCCTACGC targeting the 5' side and TAGCATACGTCACGCCGGAA targeting the 3' side of the target region on Chr3. This resulted in a 9,032-bp deletion Chr3:34800126 to 34809158 (GRCm39).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Del(3)1Tcp,
  • mSRR96-102 knockout,
  • mSRR96-102 knockout,
  • deltamENH,
  • deltamENH,
  • Del1Tcp,
  • Chr3 SRR124-SRR134 del,
  • Chr3 SRR124-SRR134 del,
  • Del1Tcp,
  • Del(3)1Tcp
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele