|  Help  |  About  |  Contact Us

Allele : Npsr1<em1Yfu> neuropeptide S receptor 1; endonuclease-mediated mutation 1, Ying-Hui Fu

Primary Identifier  MGI:7284431 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Npsr1
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting ) and an ssODN template (GTCCAGCCCGTGGCCTCTCACCTGATAATTGCCAAGGGAATGAAGTACACCAGAAAGGCGACGATGGTCATGTACGGGGTCCAGTGCGAGTCATCCGGCCACAGTGCCCAGCACTGCACCTCACCATTGGAAAGTGTCCTTTTCCCAAATATGATCAGCGTGGGAATGGAGA) with CRISPR/Cas9 technology, tyrosine codon 206 (TAC) was changed to histidine (CAC) (p.Y206H). This mutation is located in a highly conserved extra-cellular domain and the equivalent mutation in humans is associated with familial natural short sleep (FNSS).
  • mutations:
  • Single point mutation
  • synonyms:
  • Npsr1-Y206H,
  • Npsr1<m>,
  • Npsr1-Y206H,
  • Npsr1<m>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories