| Primary Identifier | MGI:7284431 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Npsr1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using an sgRNA (targeting ) and an ssODN template (GTCCAGCCCGTGGCCTCTCACCTGATAATTGCCAAGGGAATGAAGTACACCAGAAAGGCGACGATGGTCATGTACGGGGTCCAGTGCGAGTCATCCGGCCACAGTGCCCAGCACTGCACCTCACCATTGGAAAGTGTCCTTTTCCCAAATATGATCAGCGTGGGAATGGAGA) with CRISPR/Cas9 technology, tyrosine codon 206 (TAC) was changed to histidine (CAC) (p.Y206H). This mutation is located in a highly conserved extra-cellular domain and the equivalent mutation in humans is associated with familial natural short sleep (FNSS). |
