| Primary Identifier | MGI:7294193 | Allele Type | Endonuclease-mediated |
| Attribute String | Recombinase | Gene | Sp7 |
| Strain of Origin | C57BL/6 x SJL | Is Recombinase | true |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 endonuclease-mediated genome editing was used to insert an in frame protein containing Sp7-P2A-Flpo sequence- polyA into the 3' UTR of the gene The self-cleaving P2A sequence allows for expression of Sp7 and flpo recombinase. Cas9 protein, sgRNA (gatctgagctgggtagaggaagg), and ssDNA donor were mixed and injected into the pronucleus of C57BL/6J x SJL fertilized zygotes. |