|  Help  |  About  |  Contact Us

Allele : Sp7<em1(flpo)Oam> Sp7 transcription factor 7; endonuclease-mediated mutation 1, Ormond A MacDougald

Primary Identifier  MGI:7294193 Allele Type  Endonuclease-mediated
Attribute String  Recombinase Gene  Sp7
Strain of Origin  C57BL/6 x SJL Is Recombinase  true
Is Wild Type  false
molecularNote  CRISPR/cas9 endonuclease-mediated genome editing was used to insert an in frame protein containing Sp7-P2A-Flpo sequence- polyA into the 3' UTR of the gene The self-cleaving P2A sequence allows for expression of Sp7 and flpo recombinase. Cas9 protein, sgRNA (gatctgagctgggtagaggaagg), and ssDNA donor were mixed and injected into the pronucleus of C57BL/6J x SJL fertilized zygotes.
  • mutations:
  • Insertion
  • synonyms:
  • Osterix-FLPo,
  • Osterix-FLPo
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

1 Driven By

Trail: Allele

4 Publication categories

Trail: Allele