| Primary Identifier | MGI:7281512 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Adar |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using an sgRNA (targeting GAAGGGGGAAACCTCCTTTGTGG) and an ssODN template (ATCAATCGTATTTTGTACTCCCTGGAAAAGAAGGGAAAGCTGCACAGAGGAAGGGGGAAACCTGCCTTGTGGAGCCTTGTGCCCTTGAGTCAGGCTTGGACTCAGCCCCCTGGAGTTGTGAATCCAGAT) with CRISPR/Cas9 technology, proline codon 195 (CCT) was changed to alanine (GCC) (p.P195A). The mutation affects the Z-alpha Z-DNA-binding domain in the encoded peptide and is equivalent to the p.P193A mutation found in Aicardi-Goutieres syndrome (AGS) patients. |
