|  Help  |  About  |  Contact Us

Allele : Adar<em1Stsn> adenosine deaminase, RNA-specific; endonuclease-mediated mutation 1, Daniel B Stetson

Primary Identifier  MGI:7281512 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Adar
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting GAAGGGGGAAACCTCCTTTGTGG) and an ssODN template (ATCAATCGTATTTTGTACTCCCTGGAAAAGAAGGGAAAGCTGCACAGAGGAAGGGGGAAACCTGCCTTGTGGAGCCTTGTGCCCTTGAGTCAGGCTTGGACTCAGCCCCCTGGAGTTGTGAATCCAGAT) with CRISPR/Cas9 technology, proline codon 195 (CCT) was changed to alanine (GCC) (p.P195A). The mutation affects the Z-alpha Z-DNA-binding domain in the encoded peptide and is equivalent to the p.P193A mutation found in Aicardi-Goutieres syndrome (AGS) patients.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Adar<P195A>,
  • Adar<P195A>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories

Trail: Allele