| Primary Identifier | MGI:7281840 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence, Hypomorph | Gene | Hsf2bp |
| Strain of Origin | (C57BL/6J x CBA/J)F2 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 technology, using an sgRNA (targeting TCACAAAACTCTCCATCGTC and ATTGGATGGGGATGTCAAGG) and ssODN template, generated a C-to-T change at coding nucleotide 512 (c.512C>T) resulting in a serine to leucine substitution at amino acid 171 (p.S171L) that corresponds to the human p.S167L mutation found in a clinical case with primary ovarian insufficiency. Immunofluorescence shows reduced protein expression in testes lysates. |