|  Help  |  About  |  Contact Us

Allele : Taok1<em1(IMPC)Tcp> TAO kinase 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:7293333 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Taok1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GAAAAGCAAATACCGCCGGG targeting the 5' side and AAACATTAAACTAGGCGGTC targeting the 3' side of a critical region (ENSMUSE00000520605) along with a single-strand oligonucleotide encoding a Bxb1 attB site. This resulted in a 1292-bp deletion of Chr11 from 77,465,754 to 77,467,045 (GRCm39) with an insertion of a Bxb1 attB sequence (GGCTTGTCGACGACGGCGGTCTCCGTCGTCAGGATCATACACCGG).
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories