| Primary Identifier | MGI:7284812 | Allele Type | Endonuclease-mediated |
| Attribute String | No functional change | Gene | Pak1 |
| Strain of Origin | FVB/N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Using an sgRNA (targeting GCACTGAAGAGAATTGCATCTGG) and an ssODN templates (CTGCTGGATTACTCGTCCAGATGCAATTCTCTTCAGTGCTAGACAGTTTC) with CRISPR technology, 3' UTR mutation c.*171T>A (minor allele of SNP rs3654376) was introduced to make the 3' UTR in this FVB/N strain similar to that in the MSM/Ms (Mishima Mus musculus molossinus) strain. |
