|  Help  |  About  |  Contact Us

Allele : Del(11Myh1-Myh4)1Mair deletion, Chr11, Pascal Maire 1

Primary Identifier  MGI:7285972 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Del(11Myh1-Myh4)1Mair
Is Recombinase  false Is Wild Type  false
molecularNote  The genomic sequence containing Myh1 and Myh4 (chr11:67090357-67152023 GRCm39) was deleted using sgRNAs (targeting ATGAGTGTGTGGCTAGGCAACGG, GTGGCTAGGCAACGGTTTGGGGG, ATGATTTGACAGTGAGTCAGAGG, GGGTTCTCATGCTAACACAGAGG, AAGTGAAGTGGATAACCACAGGG and CAGAATGGCAGACGGCCCTGTGG) with CRISPR/Cas9 technology.
  • mutations:
  • Intergenic deletion,
  • Intragenic deletion
  • synonyms:
  • Myh(1-4)<Del>,
  • Myh(1-4)<Del>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

2 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories