|  Help  |  About  |  Contact Us

Allele : Rr201<em1Cecad> regulatory region 201; endonuclease-mediated mutation 1, CECAD, University of Cologne

Primary Identifier  MGI:7286313 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr201
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Using gRNAs (targeting TCTTTCAGCGATGATCCGGG and AGCGCGCTTAACAAGCATTA) with CRISPR/Cas9 technology, the poised enhancer located 109 kb upstream of Lhx5 was deleted.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • PE Lhx5(-109kb)<->,
  • PE Lhx5(-109kb)<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories