|  Help  |  About  |  Contact Us

Allele : Ap5s1<em1(IMPC)J> adaptor-related protein 5 complex, sigma 1 subunit; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7378565 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ap5s1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGGCACTAGATTATTCAG and AGCAGACTCCCACTCACAAG, which resulted in a 2400 bp deletion beginning at Chromosome 2 position 131,211,143 bp and ending after 131,213,542 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000558540, ENSMUSE00001373302, ENSMUSE00000558538 (exons 2, 3, and 4) and 1210 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories