| Primary Identifier | MGI:7330383 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp551 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAATCTCTGAATTCAGAGA and AGATGCTAATGAAGTAATGC, which resulted in a 2174 bp deletion beginning at Chromosome 7 position 12,415,086 bp and ending after 12,417,259 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000479797 (exon 4) and 108 bp of flanking intronic sequence including the splice acceptor and 3â UTR and is predicted to cause a change of amino acid sequence after residue 88 and truncation 20 amino acids later by run on translation. There is a 3 bp insertion ATT at the deletion site. |