|  Help  |  About  |  Contact Us

Allele : Zfp551<em1(IMPC)J> zinc finger protein 551; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7330383 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp551
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAATCTCTGAATTCAGAGA and AGATGCTAATGAAGTAATGC, which resulted in a 2174 bp deletion beginning at Chromosome 7 position 12,415,086 bp and ending after 12,417,259 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000479797 (exon 4) and 108 bp of flanking intronic sequence including the splice acceptor and 3’ UTR and is predicted to cause a change of amino acid sequence after residue 88 and truncation 20 amino acids later by run on translation. There is a 3 bp insertion ATT at the deletion site.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele