| Primary Identifier | MGI:7331504 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Irgq |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAGTGAATCAGTTAGGAGA and CCATGTGCTTGTCTACGGAG, which resulted in a 7630 bp deletion beginning at Chromosome 7 position 24,531,163 bp and ending after 24,538,792 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000404079 and ENSMUSE00000317876 (exons 2 and 3) and 1763 bp of intronic sequence including the splice acceptor and donor the start site and 3â UTR and is predicted to result in a null allele. |
