|  Help  |  About  |  Contact Us

Allele : Rr253<em1Kmm> regulatory region 253; endonuclease-mediated mutation 1, Kenneth M Murphy

Primary Identifier  MGI:7331606 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr253
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  The Zeb2 enhancer, containing four E-boxes and located ~165 kb upstream, was targeted with sgRNAs (targeting GAGAGATCATCAAATG and GATAACGTTCTTGAAGCATA) using CRISPR/Cas9 technology, resulting in a 364 bp deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • Zeb2<delta-165>,
  • Zeb2<delta-165>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories