| Primary Identifier | MGI:7331606 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr253 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The Zeb2 enhancer, containing four E-boxes and located ~165 kb upstream, was targeted with sgRNAs (targeting GAGAGATCATCAAATG and GATAACGTTCTTGAAGCATA) using CRISPR/Cas9 technology, resulting in a 364 bp deletion. |
