| Primary Identifier | MGI:7331607 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr253 |
| Strain of Origin | STOCK Zeb2<tm2.1Yhi>/2YhiRbrc | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The Zeb2 enhancer, containing four E-boxes and located ~165 kb upstream, was targeted with sgRNAs (targeting GAGAGATCATCAAATG and GATAACGTTCTTGAAGCATA) using CRISPR/Cas9 technology, resulting in a 368 bp deletion. The allele was created in zygotes containing the Zeb2tm2.1Yhi allele. |
