| Primary Identifier | MGI:7327089 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gng12 |
| Inheritance Mode | Not Specified | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TCGTCACCAAAATTACTGCA and CCTTCCTCACGCCATCCCTA, which resulted in a 5857 bp deletion beginning at Chromosome 6 position 67,015,601 bp and ending after 67,021,457 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000256838 and ENSMUSE00000698574 (exons 3,4) and 4115 bp of flanking intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele. There is a 2 bp (CT) insertion at the deletion site. |
