|  Help  |  About  |  Contact Us

Allele : Gng12<em1(IMPC)J> guanine nucleotide binding protein (G protein), gamma 12; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7327089 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gng12
Inheritance Mode  Not Specified Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TCGTCACCAAAATTACTGCA and CCTTCCTCACGCCATCCCTA, which resulted in a 5857 bp deletion beginning at Chromosome 6 position 67,015,601 bp and ending after 67,021,457 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000256838 and ENSMUSE00000698574 (exons 3,4) and 4115 bp of flanking intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele. There is a 2 bp (CT) insertion at the deletion site.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele