|  Help  |  About  |  Contact Us

Allele : Rr44605<em2Ddu> regulatory region 44605; endonuclease-mediated mutation 2, Denis Duboule

Primary Identifier  MGI:7327113 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr44605
Strain of Origin  C57BL/6 x CBA Is Recombinase  false
Is Wild Type  false
molecularNote  Using two sgRNAs (targeting GCGCCTGTGATAGTGCGCGT and CGCTGTTGTCCGTGCTTACG) with CRISPR/Cas9 technology, a 45 bp deletion (CGCACTATCACAGGCGCTTAGTAGATGTCGCTGTTGTCCGTGCTT) was created in this Hoxd CTCF binding site region.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • deltaCBS4',
  • deltaCBS4',
  • deltaCB4',
  • deltaCB4'
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories