|  Help  |  About  |  Contact Us

Allele : Rr44604<em1Ddu> regulatory region 44604; endonuclease-mediated mutation 1, Denis Duboule

Primary Identifier  MGI:7327114 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr44604
Strain of Origin  C57BL/6 x CBA Is Recombinase  false
Is Wild Type  false
molecularNote  Using an sgRNA (targeting GAACTTCTACAGCCACACGA) with CRISPR/Cas9 technology, a 6 bp deletion (AGCCAC) was created in this Hoxd CTCF binding site region.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • deltaCB5,
  • deltaCB5
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories