| Primary Identifier | MGI:7327103 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Epha1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Guide RNAs (AGCTGGTGAAGAAAGAACCG and CAAGTCAGCTCCAGCTGCCT) are designed to create a CCG to TTG missense mutation resulting in a proline to leucine mutation (P461L) orthologous to the location of human SNP rs202178565 in the Eph receptor A1 (Epha1) gene. Human SNP rs202178565 has been found in human EPHA1 and is associated with increased risk of sporadic Alzheimer's disease (AD). |