| Primary Identifier | MGI:7332988 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rr29 |
| Strain of Origin | FVB | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Sequence for Shh enhancer ZRS or MFCS1 (mammals-fish conserved sequence 1), located in intron 5 of Lmbr1, was deleted using an sgRNA (targeting GAACCTCACACATGATCTAT) with CRISPR/Cas9 technology. The deletion spans 1324 bp (chr5:29519495-29520818 (GRCm39)). |
