|  Help  |  About  |  Contact Us

Allele : 4933405L10Rik<em1(IMPC)J> RIKEN cDNA 4933405L10 gene; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7328446 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  4933405L10Rik
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, CTAAGGCGAACAGCCTTCTG and GCTGGTCGTGTGGATCAGTG, which resulted in a 2081 bp deletion beginning at Chromosome 8 position 105,708,250 bp and ending after 105,710,330 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000214417, ENSMUSE00000214420, ENSMUSE00000214418 and ENSMUSE00000214419 (exons 1, 2, 3 and 4) and 867 bp of intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories