| Primary Identifier | MGI:7328446 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | 4933405L10Rik |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, CTAAGGCGAACAGCCTTCTG and GCTGGTCGTGTGGATCAGTG, which resulted in a 2081 bp deletion beginning at Chromosome 8 position 105,708,250 bp and ending after 105,710,330 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000214417, ENSMUSE00000214420, ENSMUSE00000214418 and ENSMUSE00000214419 (exons 1, 2, 3 and 4) and 867 bp of intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. |