|  Help  |  About  |  Contact Us

Allele : Ramac<em1(IMPC)J> RNA guanine-7 methyltransferase activating subunit; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7328450 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ramac
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TCTTGACTACACTACGCTAT and TCATTACCACATAAATAAAT, which resulted in a 2137 bp deletion beginning at Chromosome 7 position 81,767,381 bp and ending after 81,769,517 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000311576 and ENSMUSE00000423698 (exons 2 and 3) and 817 bp of intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Ramac<->,
  • Ramac<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories