| Primary Identifier | MGI:7328450 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ramac |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, TCTTGACTACACTACGCTAT and TCATTACCACATAAATAAAT, which resulted in a 2137 bp deletion beginning at Chromosome 7 position 81,767,381 bp and ending after 81,769,517 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000311576 and ENSMUSE00000423698 (exons 2 and 3) and 817 bp of intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. |