| Primary Identifier | MGI:7334831 | Allele Type | Endonuclease-mediated |
| Attribute String | Epitope tag, Null/knockout | Gene | Arid5a |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 genome editing uses sgRNAs (ATAGGCTCTGGCCTACAGTTTGG and GTAAAAGCCAAATGCGCCCCAGG) to insert a loxP site in intron 2 and a Myc-tag at the C-terminal, with another loxP site, just after the stop codon. A founder was identified carrying a deletion between the two SpyCas9 target sites, with a deletion of 3,359 bp deletion on chromosome 1 between position 36,316,840 and 36,320,199 (exons 3-6 and part of exon 7). |
