|  Help  |  About  |  Contact Us

Allele : Arid5a<em1Gaff> AT-rich interaction domain 5A; endonuclease-mediated mutation 1, Sarah Gaffen

Primary Identifier  MGI:7334831 Allele Type  Endonuclease-mediated
Attribute String  Epitope tag, Null/knockout Gene  Arid5a
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 genome editing uses sgRNAs (ATAGGCTCTGGCCTACAGTTTGG and GTAAAAGCCAAATGCGCCCCAGG) to insert a loxP site in intron 2 and a Myc-tag at the C-terminal, with another loxP site, just after the stop codon. A founder was identified carrying a deletion between the two SpyCas9 target sites, with a deletion of 3,359 bp deletion on chromosome 1 between position 36,316,840 and 36,320,199 (exons 3-6 and part of exon 7).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele