|  Help  |  About  |  Contact Us

Allele : Pgpep1<em1(IMPC)J> pyroglutamyl-peptidase I; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7330093 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pgpep1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCTAGTGTGGACCATAGCG and TCCAGGCGTGTGATTCTTGG, which resulted in a 13601 bp deletion beginning at Chromosome 8 position 70,646,368 bp and ending after 70,659,968 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000349254, ENSMUSE00000213761, ENSMUSE00000213760, ENSMUSE00000437318 and ENSMUSE00000437329 (exons 1-5) and 8718 bp of intronic sequence including the start site, splice acceptor and donor as well as 3’UTR and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories