| Primary Identifier | MGI:7333232 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region, Null/knockout | Gene | Rr265 |
| Strain of Origin | C57BL/6 x CBA | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This Lmx1b-binding sites containing Lmx1b enhancer, driving expression in limbs, was targeted with sgRNAs (targeting TTCCCTTTTGAACCTTGCGG and CAGCCCCAGAATCTAGGCGC) using CRISPR/Cas9 technology, resulting in a deletion. |
