|  Help  |  About  |  Contact Us

Allele : Rr265<em1Maros> regulatory region 265; endonuclease-mediated mutation 1, Marian A Ros

Primary Identifier  MGI:7333232 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region, Null/knockout Gene  Rr265
Strain of Origin  C57BL/6 x CBA Is Recombinase  false
Is Wild Type  false
molecularNote  This Lmx1b-binding sites containing Lmx1b enhancer, driving expression in limbs, was targeted with sgRNAs (targeting TTCCCTTTTGAACCTTGCGG and CAGCCCCAGAATCTAGGCGC) using CRISPR/Cas9 technology, resulting in a deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • deltaLARM2,
  • deltaLARM2
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele