| Help | About | Contact Us

Allele : Il4ra<em1Amen> interleukin 4 receptor, alpha; endonuclease-mediated mutation 1, Sarah Amend

Primary Identifier	MGI:7334731	Allele Type	Endonuclease-mediated
Attribute String	Null/knockout	Gene	Il4ra
Strain of Origin	FVB/NJ	Is Recombinase	false
Is Wild Type	false

molecularNote

CRISPR/cas9 genome editing uses guide RNAs to target upstream [CACCACGTTAAAGCACAGGG; GCTCCCACCACTAAGGTCAG] and downstream [GCTTGTGGCAGCTTACTGAG; GCTCAACTGTAGTATCACGC] of exon 4. Il4ra transcript Il4ra-201 was used as reference for the exon number and the guide sequences

mutations:
Intragenic deletion

earliestPublication:
de Groot AE, et al. (2022) Targeting interleukin 4 receptor alpha on tumor-associated macrophages reduces the pro-tumor macrophage phenotype. Neoplasia 32:100830

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

Other

1 Carried By

0 Driven By

3 Publication categories

Questions? Comments? Click here!

MouseMine is a collaboration between MGI at The Jackson Laboratory and the InterMine project at the Cambridge Systems Biology Centre. MouseMine is funded through a grant from the NIH/NHGRI.The Jackson Laboratory makes no representation about the suitability or accuracy of this software or data for any purpose, and makes no warranties, either express or implied, including merchantability and fitness for a particular purpose or that the use of this software or data will not infringe any third party patents, copyrights, trademarks, or other rights. the software and data are provided "as is". This software and data are provided to enhance knowledge and encourage progress in the scientific community and are to be used only for research and educational purposes. Any reproduction or use for commercial purpose is prohibited without the prior express written permission of the Jackson Laboratory.

Your name:
Your email address:
Subject:
Message:	---- Current page: ---- /mousemine/report.do?id=76796579

MouseMine