|  Help  |  About  |  Contact Us

Allele : Il4ra<em1Amen> interleukin 4 receptor, alpha; endonuclease-mediated mutation 1, Sarah Amend

Primary Identifier  MGI:7334731 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Il4ra
Strain of Origin  FVB/NJ Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 genome editing uses guide RNAs to target upstream [CACCACGTTAAAGCACAGGG; GCTCCCACCACTAAGGTCAG] and downstream [GCTTGTGGCAGCTTACTGAG; GCTCAACTGTAGTATCACGC] of exon 4. Il4ra transcript Il4ra-201 was used as reference for the exon number and the guide sequences
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele