|  Help  |  About  |  Contact Us

Allele : Rr29<em6Axvi> regulatory region 29; endonuclease-mediated mutation 6, Axel Visel

Primary Identifier  MGI:7334961 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region, Null/knockout Gene  Rr29
Strain of Origin  FVB Is Recombinase  false
Is Wild Type  false
molecularNote  Sequence for Shh enhancer ZRS or MFCS1 (mammals-fish conserved sequence 1), located in intron 5 of Lmbr1, was replaced with a modified version of the orthologous Burmese python sequence (JH127332:522,984-524,307 (latCha1)) using an sgRNA (targeting AGTACCATGCGTGTGTGTGA) and a plasmid DNA template with CRISPR/Cas9 technology. The modification involves "resurrecting" the snake sequence to be similar to other vertebrates by inserting the 17 bases (CTGAGGTAACTTCCTTG, overlapping an ETS1 binding site) missing in snakes.
  • mutations:
  • Intragenic deletion,
  • Insertion
  • synonyms:
  • Shh-pZRS(r)<em6Axvi>,
  • Shh-pZRS(r)<em6Axvi>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories