| Primary Identifier | MGI:7335223 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region, Null/knockout | Gene | Del(2Rr263-Rr264)1Maros |
| Strain of Origin | C57BL/6 x CBA | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A Lmx1b-binding sites containing Lmx1b enhancer and suppressor region, regulating expression in limbs, was targeted with sgRNAs (targeting TGGTCCCCAGATATTATGG and GGTCGGCACTGTAAATGTTG) using CRISPR/Cas9 technology, resulting in a deletion. The deleted region contains enhancer Rr263 and suppressor Rr264. |