|  Help  |  About  |  Contact Us

Allele : B4galnt4<em1(IMPC)J> beta-1,4-N-acetyl-galactosaminyl transferase 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7344348 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  B4galnt4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTCTGAGAGGATCACCAGA and AACATGGGCGAGGGTCAGGA, which resulted in a 1998 bp deletion beginning at Chromosome 7 position 141,063,569 bp and ending after 141,065,566 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000526246, ENSMUSE00000526245, ENSMUSE00000411875, ENSMUSE00000378279, ENSMUSE00000367568, ENSMUSE00000375760, and ENSMUSE00000350598 (exons 2-8) and 1363 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 13 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories