| Primary Identifier | MGI:7344348 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | B4galnt4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTCTGAGAGGATCACCAGA and AACATGGGCGAGGGTCAGGA, which resulted in a 1998 bp deletion beginning at Chromosome 7 position 141,063,569 bp and ending after 141,065,566 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000526246, ENSMUSE00000526245, ENSMUSE00000411875, ENSMUSE00000378279, ENSMUSE00000367568, ENSMUSE00000375760, and ENSMUSE00000350598 (exons 2-8) and 1363 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 13 amino acids later. |
