| Primary Identifier | MGI:7344357 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Saa4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCATGGATGGTCTACTCCA and GATGAACAAATGGTTAATGC, which resulted in a 4149 bp deletion beginning at Chromosome 7 position 46,727,816 bp and ending after 46,731,964 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000204208, ENSMUSE00000204214, ENSMUSE00000353026 (exons 2-4) and 2228 bp of flanking intronic sequence including the start sit, splice acceptor and donor and is predicted to result in a null allele. |