|  Help  |  About  |  Contact Us

Allele : Saa4<em1(IMPC)J> serum amyloid A 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7344357 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Saa4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCATGGATGGTCTACTCCA and GATGAACAAATGGTTAATGC, which resulted in a 4149 bp deletion beginning at Chromosome 7 position 46,727,816 bp and ending after 46,731,964 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000204208, ENSMUSE00000204214, ENSMUSE00000353026 (exons 2-4) and 2228 bp of flanking intronic sequence including the start sit, splice acceptor and donor and is predicted to result in a null allele.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele