| Primary Identifier | MGI:7346183 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready | Gene | Rgs2 |
| Strain of Origin | (C57BL/6J x SJL/J)F1/J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 genome editing uses guide RNAs (ATGAGCTTTACAAGCAGGAT and GCTGGGATGAGAGGCGCACA) to insert loxP sited in the introns flanking exons 2-4. Rgs2 transcript Rgs2-202 was used as reference for the exon number and the guide sequences. |