| Primary Identifier | MGI:7330221 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Msantd3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACATTTTGTAGTATTAGAGT and GTATAAATCCTAACCCCGAT, which resulted in a 9774 bp deletion beginning at Chromosome 4 position 48,552,345 bp and ending after 48,562,118 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000410568 and ENSMUSE00001226920 (exons 2 and 3) and 8248 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. |
